Ll_transcript_249672

• Id Trinity: FTRINITY_DN55944_c0_g2_i19
• Name Transcript: Ll_transcript_249672
• Sequence: GGATACCGAACCACGTGGAATCAAAAATTTCTTAGGTCAAATTTGAGGCGCCATGTATGGAATGATGACTATTAGCATCAATTTTCCTCTGACTCAGATA CCAAAAATGAAAACATGGATTACCAATTCAAAATCAAATAATAAAAAGTTTTGGCCGTCACACATATTCCACAACCATAAAGGAACTAATACCACTGTGC TGTGTTCTGCTCCTGATATAAACCCTATGGCGCTTCGTTTTGAGGTTCTTGCCAGGTTCAACCGAGCTCGTGCAGCTCGATTGACACTCCCTCACTTTGT GTGTGAAACGCCTTTATTTATGCCAGTAGGCACACAAGGGACTATAAAAGGATTGACTAATAGCCAGCTTGAGGATATTGGCTGCCA
• Tissue: flowers
• Gene name: LI_gene_55900;
• Additional information: details;

Expression of Ll_transcript_249672

FPKM

• FPAB: 0
• FPNAB: 0.8
• LF1: 0
• LF2: 0.1
• LF3: 0
• LF4: 0.7
• UF1: 0
• UF2: 0.6
• UF3: 1
• UF4: 1

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_249672

• Blastp: Queuine tRNA-ribosyltransferase catalytic subunit 1 from Danio with 57.41% of identity
• Blastx: Queuine tRNA-ribosyltransferase catalytic subunit 1 from Danio with 57.41% of identity
• Eggnog: Exchanges the guanine residue with 7-aminomethyl-7- deazaguanine in tRNAs with GU(N) anticodons (tRNA-Asp, -Asn, -His and -Tyr). After this exchange, a cyclopentendiol moiety is attached to the 7-aminomethyl group of 7-deazaguanine, resulting in the hypermodified nucleoside queuosine (Q) (7-(((4,5-cis- dihydroxy-2-cyclopenten-1-yl)amino)methyl)-7-deazaguanosine) (By similarity)(COG0343)
• Kegg: Link to kegg annotations (393985)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019416066.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;