Ll_transcript_107369

• Id Trinity: FTRINITY_DN880_c0_g1_i1
• Name Transcript: Ll_transcript_107369
• Sequence: GTATTGGTACCGGTTGGAGTACCAAAGTTCCAAACTTTAACCCTCGTGAAATAGCTCAAAATATTAAACGCATGATTCATGGCGATGATGCGCTTCCTAT GATCCCTTGGTACAGAAAGTACACAGGTTTCATTGACGTTTTGGGTGAAACCAGATTTGCATCTTATGGAGAAGTAGCTGTTTTGAGTGAGACTCAAATT GAAATAACTGAACTACCTGTTGGAAAGTGGACCAATGATTACAAAGAAAGTGTGCTGGACCCAATGTTGAAC
• Tissue: flowers
• Gene name: LI_gene_114954;
• Additional information: -

Expression of Ll_transcript_107369

FPKM

• FPAB: 0.7
• FPNAB: 0
• LF1: 0
• LF2: 0
• LF3: 0
• LF4: 0
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_107369

• Blastp: -
• Blastx: Probable DNA topoisomerase 2 from Caenorhabditis with 55.06% of identity
• Eggnog: DNA gyrase negatively supercoils closed circular double- stranded DNA in an ATP-dependent manner and also catalyzes the interconversion of other topological isomers of double-stranded DNA rings, including catenanes and knotted rings (By similarity)(COG0187)
• Kegg: Link to kegg annotations (CELE_K12D12.1)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_004499912.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;