Id Trinity | FTRINITY_DN880_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_107369 |
Sequence | GTATTGGTACCGGTTGGAGTACCAAAGTTCCAAACTTTAACCCTCGTGAAATAGCTCAAAATATTAAACGCATGATTCATGGCGATGATGCGCTTCCTAT GATCCCTTGGTACAGAAAGTACACAGGTTTCATTGACGTTTTGGGTGAAACCAGATTTGCATCTTATGGAGAAGTAGCTGTTTTGAGTGAGACTCAAATT GAAATAACTGAACTACCTGTTGGAAAGTGGACCAATGATTACAAAGAAAGTGTGCTGGACCCAATGTTGAAC BLAST |
Tissue | flowers |
Gene name | LI_gene_114954; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_107369
Blastp | - |
---|---|
Blastx | Probable DNA topoisomerase 2 from Caenorhabditis with 55.06% of identity |
Eggnog | DNA gyrase negatively supercoils closed circular double- stranded DNA in an ATP-dependent manner and also catalyzes the interconversion of other topological isomers of double-stranded DNA rings, including catenanes and knotted rings (By similarity)(COG0187) |
Kegg | Link to kegg annotations (CELE_K12D12.1) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_004499912.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |