| Id Trinity | TRINITY_DN53059_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_499474 |
| Sequence | CCTAGACTCTTGTTCGTTCAACACATAAGATGCACCCATCTTTGATAACCTTGTCATCCATTCATTCACTTTTGTCTTCCCCTCAAAATCAGGCGGCAAG AACGTCAATTTATTGAGCGAACCATAAACAACAGAGAGCAATGGGTGCACGTCATCAACGGCCTGCATTCCAAGTTTCAAGGTATCCATTGCTGTAATAA AAAACâBLAST |
| Tissue | pods |
| Gene name | LI_gene_196894; |
| Additional information | - |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_499474
| Blastp | - |
|---|---|
| Blastx | Vacuolar protein sorting-associated protein 28 homolog 2 from Arabidopsis with 68.66% of identity |
| Eggnog | Vacuolar protein sorting-associated protein(ENOG4111IQ4) |
| Kegg | Link to kegg annotations (AT4G05000) |
| CantataDB | Link to cantataDB annotations (CNT0002348) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019431923.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |