ta-siRNA 276 details

ID276
SequenceAACACGACTTCTAAACTTTACAGG 

Targets of siRNA 276

LuluDB transcript

Target start position

Target end position

Target sequence

BLAST target sequence

Target details

Ll_transcript_24997; 1576 1599 CCTGTAAAGTTTAGAAGTCGTGTT BLAST
Ll_transcript_24995; 2613 2636 CCTGTAAAGTTTAGAAGTCGTGTT BLAST
Ll_transcript_930; 100 123 CCTGCAAAGTTTAGAAGTCGTGTT BLAST
Ll_transcript_24996; 217 240 CCTGTGAAGTTTAGAAGTCGTGTT BLAST
Ll_transcript_313206; 552 575 CCTGTAAAGTTTAGAAGTCGTGTT BLAST
Ll_transcript_313202; 1528 1551 CCTGTAAAGTTTAGAAGTCGTGTT BLAST
Ll_transcript_313215; 1535 1558 CCTGTAAAGTTTAGAAGTCGTGTT BLAST
Ll_transcript_313226; 1528 1551 CCTGTAAAGTTTAGAAGTCGTGTT BLAST
Ll_transcript_313208; 1535 1558 CCTGTAAAGTTTAGAAGTCGTGTT BLAST
Ll_transcript_313212; 1528 1551 CCTGTAAAGTTTAGAAGTCGTGTT BLAST
Ll_transcript_313198; 1535 1558 CCTGTAAAGTTTAGAAGTCGTGTT BLAST
Ll_transcript_313196; 1026 1049 CCTGTGAAGTTTAGAAGTCGTGTT BLAST
Ll_transcript_313199; 1026 1049 CCTGTGAAGTTTAGAAGTCGTGTT BLAST
Ll_transcript_313216; 1026 1049 CCTGTGAAGTTTAGAAGTCGTGTT BLAST
Ll_transcript_249554; 518 541 CCTAAGAAGTTTGGTGGTCGTGGT BLAST
Ll_transcript_249554; 518 541 CCTAAGAAGTTTGGTGGTCGTGGT BLAST
Ll_transcript_249559; 518 541 CCTAAGAAGTTTGGTGGTCGTGGT BLAST

Expression of siRNA 276


Labels

FPAB_1 abscising flower pedicels (replicate 1)      PAB_1 abscising pods (replicate 1)      PW2_1   pods wall stages 4-6 (replicate 1)
FPAB_2 abscising flower pedicels (replicate 2)      PAB_2 abscising pods (replicate 2)      PW2_2   pods wall stages 4-6 (replicate 2)
FPNAB_1   non-abscising flower pedicels (replicate 1)        PNAB_1   non-abscising pods (replicate 1)        PW3_1   pods wall stages 7-8 (replicate 1)
FPNAB_2   non-abscising flower pedicels (replicate 2)        PNAB_2   non-abscising pods (replicate 2)        PW3_2   pods wall stages 7-8 (replicate 2)
LF1_1 lower flowers stage 1 (replicate 1)      PS1_1 seeds stages 1-3 (replicate 1)      UF1_1 upper flowers stage 1 (replicate 1)
LF1_2 lower flowers stage 1 (replicate 2)      PS1_2 seeds stages 1-3 (replicate 2)      UF1_2 upper flowers stage 1 (replicate 2)
LF2_1 lower flowers stage 2 (replicate 1)      PS2_1 seeds stages 4-6 (replicate 1)      UF2_1 upper flowers stage 2 (replicate 1)
LF2_2 lower flowers stage 2 (replicate 2)      PS2_2 seeds stages 4-6 (replicate 2)      UF2_2 upper flowers stage 2 (replicate 2)
LF3_1 lower flowers stage 3 (replicate 1)      PS3_1 seeds stages 7-8 (replicate 1)      UF3_1 upper flowers stage 3 (replicate 1)
LF3_2 lower flowers stage 3 (replicate 2)      PS3_2   seeds stages 7-8 (replicate 2)        UF3_2 upper flowers stage 3 (replicate 2)
LF4_1 lower flowers stage 4 (replicate 1)      PW1_1   pods wall stages 1-3 (replicate 1)        UF4_1 upper flowers stage 4 (replicate 1)
LF4_2 lower flowers stage 4 (replicate 2)      PW1_2   pods wall stages 1-3 (replicate 2)        UF4_2 upper flowers stage 4 (replicate 2)