| Id Trinity | FTRINITY_DN10522_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_70494 |
| Sequence | AGGCTTGTGCTGCCCATGGGCCACAAGGCCGGTATGCCCTTCTCCCTGTTCGTCATGGTCACCCCCTACGGCGCCGCTGAGGAGACCGCCCAGTACTACG GCCAGAACACCGGTGTGCAGAACTTCCAGTCCTGCAACGGTCTGACCGCCGCCCTCGACAACCAGCCCCTTGGCTTCCCCTTCGACCGCGAGATCGTCGA CTTCAACCAGTTCTTCACGCCCAACATGTACTTCAAGGACGTCTCCATCTACCAGAAGTCCTCCCAGCAGGTCCACCAGGGCAACAACCTCCCAGCCTAA GCTCTCTGTGATACACAGCTCGTAATTCTAATTTTGTACGGTTCACCTCATCTTTGTTTCTTTGCCACAGCTTAAAAATAAAT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_123; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_70494
| Blastp | Larval serum protein 1 alpha chain from Sophophora with 44.57% of identity |
|---|---|
| Blastx | Larval serum protein 1 alpha chain from Sophophora with 44.57% of identity |
| Eggnog | Larval storage protein (LSP) which may serve as a store of amino acids for synthesis of adult proteins(ENOG410XR2D) |
| Kegg | Link to kegg annotations (Dmel_CG2559) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003610665.1) |
| Pfam | Hemocyanin, ig-like domain (PF03723.13) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |