Ll_transcript_243586

• Id Trinity: FTRINITY_DN17497_c0_g1_i1
• Name Transcript: Ll_transcript_243586
• Sequence: GACGCCTCAAGTATTGCTGGATGAGAGTAAAGGGTATTCTCTATCTCCACACTGCTTATATTTTCAGCACCAGATATGATTATATCCTTTGATCTGTCCT TAATTTCCATATACCCATCTGGATGCTTTACAGCAAGATCACCGGTATGAAACCATCCATTTGCAAAGGATTCTTCATTGGCTTTGGGGTTCTTTAAGTA TCCTTTCATCACAACATTACCCCTCATCACAATCTCACCAACTGTTTTACCATCGGCAGGGACAGGTTTCAGG
• Tissue: flowers
• Gene name: LI_gene_1767;
• Additional information: -

Expression of Ll_transcript_243586

FPKM

• FPAB: 0.4
• FPNAB: 1.7
• LF1: 1.6
• LF2: 1.3
• LF3: 0.4
• LF4: 0
• UF1: 0.3
• UF2: 1
• UF3: 4.2
• UF4: 3.6

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_243586

• Blastp: -
• Blastx: Acetate/butyrate--CoA ligase AAE7, peroxisomal from Arabidopsis with 79.78% of identity
• Eggnog: Amp-dependent synthetase and ligase(COG0318)
• Kegg: Link to kegg annotations (AT3G16910)
• CantataDB: Link to cantataDB annotations (CNT0001009)
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019464789.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;