Id Trinity | FTRINITY_DN382_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_169931 |
Sequence | ATTGGGAATACACACGACCGGTGTGAGCATTGTCGGTGGTGGCGTGAAAGCACCTCGTATCAAGACCAAGAATCTTATATCCGTCATCTTCTGTGAAGCG GTGGCTATCTACGGACTGATCACTGCAATTGTTATGTCTGGACAGTTGGAATCGTTCACAGACAACGTGGATACCGCACAACAAATCAGGGATCAAAATT GGATGGCCGGATATTTAATATTTGCTGCCGGTATTAGCGTAGGTCTGGTAAACCTGTTTTGCGGTATAGCTGTTGGAGTAGTGGGTTCGGGTG BLAST |
Tissue | flowers |
Gene name | LI_gene_8506; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_169931
Blastp | - |
---|---|
Blastx | V-type proton ATPase 21 kDa proteolipid subunit from Homo with 62.5% of identity |
Eggnog | F(1)F(0) ATP synthase produces ATP from ADP in the presence of a proton or sodium gradient. F-type ATPases consist of two structural domains, F(1) containing the extramembraneous catalytic core and F(0) containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation (By similarity)(COG0636) |
Kegg | Link to kegg annotations (533) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_007161243.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |