| Id Trinity | FTRINITY_DN382_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_169931 |
| Sequence | ATTGGGAATACACACGACCGGTGTGAGCATTGTCGGTGGTGGCGTGAAAGCACCTCGTATCAAGACCAAGAATCTTATATCCGTCATCTTCTGTGAAGCG GTGGCTATCTACGGACTGATCACTGCAATTGTTATGTCTGGACAGTTGGAATCGTTCACAGACAACGTGGATACCGCACAACAAATCAGGGATCAAAATT GGATGGCCGGATATTTAATATTTGCTGCCGGTATTAGCGTAGGTCTGGTAAACCTGTTTTGCGGTATAGCTGTTGGAGTAGTGGGTTCGGGTG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_8506; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_169931
| Blastp | - |
|---|---|
| Blastx | V-type proton ATPase 21 kDa proteolipid subunit from Homo with 62.5% of identity |
| Eggnog | F(1)F(0) ATP synthase produces ATP from ADP in the presence of a proton or sodium gradient. F-type ATPases consist of two structural domains, F(1) containing the extramembraneous catalytic core and F(0) containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation (By similarity)(COG0636) |
| Kegg | Link to kegg annotations (533) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_007161243.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |