| Id Trinity | FTRINITY_DN4202_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_247897 |
| Sequence | TAATGATTCATGCTATCATCAACTTGTCAGCCACTGGTTGAATACTCATGCTGTTGTTGAGCCATTTGTCATAGCAACACACAGGCAGCTCAGCGTTGTT CACCCGATTTATAAACTCTTGCATCCTCATTATCGTGACACGATGAATATTAACGCCCTTGCTAGGGGATCCCTGGTCAATGCAGATGGTATTATCGAAC AAACGTTCCTATGGGGCAGTTATGCCATGGAAATATCTTCTGTAGTTTACAAGGATTGGGTTTTTACTGATCAAGCACTACCTTCTGATCTTATCAAGAG AGGAATAGCAGTGGAGGATTCAAGTGCCCCCCATGGTCTTCACCTGGTGATAGAAGACTACCCTTATGCTGTTGATGGACTAGATATTTGGGGGGCGATT AAGACATGGGTCGAAAACTATGTCTCCCTATACTACACCTCAGACGACACAATTAAGCAAGATGTTGAACTCCAATCTTGGTGGAAAGAAGTCGTAGAGG TTGGTCACGGTGACAAGAAAGATGAGCCGTGGTGGC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_10103; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_247897
| Blastp | Seed linoleate 9S-lipoxygenase-3 from Soja with 80.9% of identity |
|---|---|
| Blastx | Seed linoleate 9S-lipoxygenase-3 from Soja with 80.9% of identity |
| Eggnog | Plant lipoxygenase may be involved in a number of diverse aspects of plant physiology including growth and development, pest resistance, and senescence or responses to wounding (By similarity)(ENOG410XT0Q) |
| Kegg | Link to kegg annotations (547869) |
| CantataDB | Link to cantataDB annotations (CNT0000973) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019443521.1) |
| Pfam | Lipoxygenase (PF00305.18) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |