| Id Trinity | FTRINITY_DN500_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_117327 |
| Sequence | AGAATGGAGAACTCTGGAAACAAATGGACGTTTTAGTTTTCAACACTTGGCTTTGGTGGTACCGTGATGGACCCAAGCAACCATGGGATTACATTCAAAC AGGCAACAAGATTGTCAAAGACATGGATCGTATGGAGGCTTTTAAAATAGGTTTGACAACTTGGGCTAAATGGGTAAATACTGAAGTTGATACACAAAAA ACCAAGGTGTTCTTTCAAGGAATTTCTCCACAACATTACCATGGCTCGGACTGGAATAAGCCAGAAGTGAGAAACTGTGCACAGGAGACATCACCAATAT CTGGATCAACA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_19579; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_117327
| Blastp | Protein trichome birefringence-like 41 from Arabidopsis with 53.92% of identity |
|---|---|
| Blastx | Protein trichome birefringence-like 41 from Arabidopsis with 53.92% of identity |
| Eggnog | Pfam:DUF231(ENOG41118PY) |
| Kegg | Link to kegg annotations (AT3G14850) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019434767.1) |
| Pfam | GDSL/SGNH-like Acyl-Esterase family found in Pmr5 and Cas1p (PF13839.5) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |