| Id Trinity | FTRINITY_DN51_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_190886 |
| Sequence | TGTTAATTTAAGTGCATTTAATGACTGACCTGGCGCTCTGCAAGCTCTCCTCTTCCTGAAAAATCCACCCGAAACAGTGCAATCACTGAATCCACAATCT GCAAAAGATCAATTCCATCAACAATCCACATCCCATGATATTGCAAAGGAAGACCAGTCTGTTAGTTAGATCTCACCAGAAGTCTAAATGGTTCTTCAGA CATTTTAGCAGCCAAACCAAGGAGGAGGTTGTACTGATGCTCATACGTGTAGGCACGAGCATAGATAATATTGTCCAGTACAGCCCCAGGATCCATTCCA AATCTCTCAGCTATGGGAACAATTCGATCAGGTCGGCTACAGGTATTTGTGATTGAA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_23492; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_190886
| Blastp | - |
|---|---|
| Blastx | Meiotic recombination protein DMC1 homolog from Soja with 71.03% of identity |
| Eggnog | Can catalyze the hydrolysis of ATP in the presence of single-stranded DNA, the ATP-dependent uptake of single-stranded DNA by duplex DNA, and the ATP-dependent hybridization of homologous single-stranded DNAs. It interacts with LexA causing its activation and leading to its autocatalytic cleavage (By similarity)(COG0468) |
| Kegg | Link to kegg annotations (548075) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_014513256.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |