Id Trinity | FTRINITY_DN549_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_117326 |
Sequence | AACGTGGGACCTCAAGTATAGGCATGTTTACATCAAGAATGGCTTAGACAATCATACTATTTTGAGATTTCGTTGTAAATCTGCGGATGATGACCTTGGC ACTCAGAATCTAAAATACGATGAGGAATTTAAGTTTCAATTTCGGCCTAGCATTTTTACAAATACAGTGTTTCATTGCAGCTTCACATGGGATGGAAAGT ATCGTACTTTTCCCATTTATGATTTTAAAAGGGATGAAAATTCTTGCCATGACTGTTACTGGAGCATAAAGCAAAATTTTCCATGTAGGTTCGATAATAA AACCCAAGGTTATGATTT BLAST |
Tissue | flowers |
Gene name | LI_gene_47664; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_117326
Blastp | S-protein homolog 5 from Arabidopsis with 39.36% of identity |
---|---|
Blastx | S-protein homolog 5 from Arabidopsis with 39.36% of identity |
Eggnog | Plant self-incompatibility protein S1(ENOG411160C) |
Kegg | Link to kegg annotations (AT1G04645) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_013468049.1) |
Pfam | Plant self-incompatibility protein S1 (PF05938.10) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |