Ll_transcript_256811

• Id Trinity: FTRINITY_DN59198_c3_g4_i1
• Name Transcript: Ll_transcript_256811
• Sequence: ATATCCATAAATATGACTGCAGTGATGTGTGTTTATTCAGCATTGTTCATGAGATTTGCTTGGGTGGTAAGACCTCGTAATCCACATCTTCTCATATGCC ATGTTTCCAATGAGACTGTGCAACTCTATCAACTCTCAAGGTGGCTAAGAGCTCAAAGGTATAAAAAAATGTTATTACATTGTTATTCTCACACCAACGG GTGTTGGTTCAAGTAGTACATGCTTGATTTCCCTTAAGTAAAGTAAAAATGTCCGGTGGGAGAGTTAGTCC
• Tissue: flowers
• Gene name: LI_gene_83752;
• Additional information: -

Expression of Ll_transcript_256811

FPKM

• FPAB: 15.7
• FPNAB: 3.3
• LF1: 11.9
• LF2: 12.8
• LF3: 23.5
• LF4: 26.8
• UF1: 6.3
• UF2: 8
• UF3: 40.4
• UF4: 48.2

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_256811

• Blastp: -
• Blastx: Mitochondrial pyruvate carrier 1 from Arabidopsis with 77.78% of identity
• Eggnog: Brain protein 44-like(ENOG4111TU9)
• Kegg: Link to kegg annotations (AT5G20090)
• CantataDB: Link to cantataDB annotations (CNT0000099)
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019438676.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;