| Id Trinity | FTRINITY_DN61353_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_86318 |
| Sequence | ACCTCAACGTATCAATGTAAACCTCTACATCATCACACTCCGCGATTTCCACATCATACGGCAGCGGTTGCTGCTTCATCCACCGCTCGCAAAGCTTCAC GGCGAAGAATCTGCTATGCGCCACCAGAATCTGGCGGTGCACGTTCATGCAAACGCTGAATCCATCTTTGGAACTCAGCGTTAGCTTTATATCGCTCGAA ACGGCGTCGTTGAACTGGTTACCGGGGCTTCGAGACCCTAACATTTCTGATATTCGCTGCATCATTAGGGTTTTCCGATCGGGTCGTTGAACCGAACCGG GAATTATGTTGTTCGGTTCGATC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_87835; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_86318
| Blastp | BTB/POZ domain-containing protein At1g63850 from Arabidopsis with 69.79% of identity |
|---|---|
| Blastx | BTB/POZ domain-containing protein At1g63850 from Arabidopsis with 69.79% of identity |
| Eggnog | BTB POZ domain-containing protein(ENOG410ZNHG) |
| Kegg | Link to kegg annotations (AT1G63850) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019424001.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |