| Id Trinity | FTRINITY_DN88264_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_243974 |
| Sequence | CCCATGTTCTATATCAATTAACACATTTCAGTATTCTCAAAAACAACCTATATAGGAGAAAGAAATTATATTTGTCAATCAATTGGTGTTAGTGCCTCAG CTCCAGCCACAATCTCTAACAGCTCCCCTGTGATCTTTGCCTGTCGTTGCCGGTTGTAGGCCATTGAGAGATTCTTCTTCAACTCAATTGCATTTTCAGT GGCATTAGACATGGCATTCATTCTTGCAGCAAGCTCACTAGCCAGTGATTCTTGCAAGCCTCTCAAAATCTGACTGTTCAGATAAAGAGGCATCATAGCA TCAAGAATCTGAACCGGATCTTGCTCAAATTGCATAAGTGGCAAGCATTCACCTCTCTTCCTATCCACGACATCCCTCTCCAAAGCCAACTTTCCTTCCT TAGTAGTCAACCTGAAAAACTCATCCTCCATCGCATCAACACAATTCCCA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_115119; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_243974
| Blastp | ATP synthase gamma chain 2, chloroplastic from Arabidopsis with 81.67% of identity |
|---|---|
| Blastx | ATP synthase gamma chain 2, chloroplastic from Arabidopsis with 81.67% of identity |
| Eggnog | Produces ATP from ADP in the presence of a proton gradient across the membrane. The gamma chain is believed to be important in regulating ATPase activity and the flow of protons through the CF(0) complex (By similarity)(COG0224) |
| Kegg | Link to kegg annotations (AT1G15700) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019417958.1) |
| Pfam | ATP synthase (PF00231.18) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |