| Id Trinity | FTRINITY_DN90065_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_97873 |
| Sequence | GAGATCAATCAGCTTTATGTCAACGGTTAACAATGGAATTTTTACATGCTGTTATTGAAGCAAAAGCATTGCGCAAAGTGTTTATTTCAATTAAGGGTTA TTACTTCCAAGCTGAAATTAAAGGTGAAACTGTCACATGGATTGTACCCCATCACTTTTCCTTTGAGCCACAACACAGAGCCGAAGTAGATTTCAAAATT ATGTCCACATTTGTTGAA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_116936; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_97873
| Blastp | - |
|---|---|
| Blastx | Pescadillo homolog from Sophophora with 75% of identity |
| Eggnog | Component of the NOP7 complex, which is required for maturation of the 25S and 5.8S ribosomal RNAs and formation of the 60S ribosome (By similarity)(COG5163) |
| Kegg | Link to kegg annotations (Dwil_GK25349) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_004508710.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |