Ll_transcript_307915

Id TrinityTRINITY_DN11249_c0_g2_i1
Name TranscriptLl_transcript_307915
SequenceTCTCTATGGACTTCATAACACACTTACCTGTATCACATGGGCATACTGTGATTTGGGTCATTGTGGATCGACTGACCAAATATGCTCACTTTGTGGGCCT TCCGACCAAGTTCACTGCCACCTCCCTGGCTCGCCGATTCCTCGATGATATTTGCAAACTGCATGGCGTTCCAAAGACAATAGTGTCAGACAGGGATAAA ATATTTCTAAGCTCTTTTTGGAAGGAAGTATTTAAACTGCTTGGTACTAAGCTTTGTTATAGCACAGCTTACCATCCTCAAACCGATGGTCAAACTGAAG TTGTTAACCGTTGCCTTCAAACCTATTTGCGTTGTTTCTCCGGTGAGTCACCACGCACATGGTTCAGCCAACTTCCTCTTGCGGAATATTGGTACAACAC TTGTT BLAST
Tissuepods
Gene nameLI_gene_119326; 
Additional informationdetails; 

Expression of Ll_transcript_307915

Labels

PAB abscising pods
PNAB non-abscising pods
PS1 seeds stages 1-3
PS2 seeds stages 4-6
PS3 seeds stages 7-8
PW1 pods wall stages 1-3
PW2 pods wall stages 4-6
PW3 pods wall stages 7-8

Annotations of Ll_transcript_307915

BlastpTransposon Tf2-6 polyprotein from Schizosaccharomyces with 40.15% of identity
BlastxTransposon Tf2-6 polyprotein from Schizosaccharomyces with 40.15% of identity
Eggnog-
KeggLink to kegg annotations (SPAC27E2.08)
CantataDB-
Mirbase-
Ncbi proteinLink to NCBI protein (XP_019450597.1)
PfamIntegrase core domain (PF00665.25)
Rfam-
GOLinks to GO: General; Genes and gene products; Annotations; Ontology;
Links to GO: General; Genes and gene products; Annotations; Ontology;