Id Trinity | TRINITY_DN11633_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_452961 |
Sequence | CGAATGGCCTTCCATTGGCTTTGTGTATAATTGGTTCTAACTTGTTTGGTAAAAGCCTAAAAGAATGGGATTCAGCATTAGATAGCTATGAAAGAGGGAC AAATAAAAGTATTCATAAAATACTTAGAGTAAGCTATGACAATTTGGAGGATAATGAGAAGGGAATTTTCCTTGACATTGCTTGTTTCTTCCAAGGTGAG AGAATGGAGTGTGTTATCAACATGTTGCTACATGGCCGTGGCTTTCGACCAGAGTATGGTATCGGAGTTTTGATGCAAAAATCTCTCTTAAGGGCTGAAT ATGGTCATGTAAGCATGCATGATTTAATAGAGGAAATGGGAG BLAST |
Tissue | pods |
Gene name | LI_gene_119463; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_452961
Blastp | Probable WRKY transcription factor 16 from Arabidopsis with 44.74% of identity |
---|---|
Blastx | Probable WRKY transcription factor 16 from Arabidopsis with 44.74% of identity |
Eggnog | Transcription factor. Interacts specifically with the W box (5'-(T)TGAC CT -3'), a frequently occurring elicitor- responsive cis-acting element(ENOG410ZRAD) |
Kegg | Link to kegg annotations (AT5G45050) |
CantataDB | - |
Mirbase | mtr-MIR2609b (MI0011863) |
Ncbi protein | Link to NCBI protein (XP_020991468.1) |
Pfam | NB-ARC domain (PF00931.21) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |