Id Trinity | TRINITY_DN330_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_428308 |
Sequence | CCATGGACAAGATCAACTCGCTCAAGAGGAAACGTGCAGGTGGCGCCGACCTCAACGACAAGGAGGACAACTTCGACGTCGCACTCGAGGACGCCGCCGT CACCGAGAAGAAGGACAGGGCAGAGCGCAAGGCCAAGGGTGCCGAGGCGGGTCAGAACAGGAAGCGTCAGAAGAAGGACGAGAAGTACGGCTTTGGCGGA AAGAAGAGACACGCCAAGAGCAACGACGCAAAGTCTTCGAGCGAGATGGGTGGCTTCTCGGCCAAGAGGATGAAGGGCAAGCCTACCGGGGGCGCTAAGC GTCCTGGCAAGTCTCAGAGAGCCG BLAST |
Tissue | pods |
Gene name | LI_gene_126362; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_428308
Blastp | Probable rRNA-processing protein ebp2 from Schizosaccharomyces with 45.13% of identity |
---|---|
Blastx | Probable rRNA-processing protein ebp2 from Schizosaccharomyces with 45.13% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (SPAC17H9.05) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003612737.2) |
Pfam | Eukaryotic rRNA processing protein EBP2 (PF05890.11) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |