Id Trinity | TRINITY_DN37051_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_297617 |
Sequence | GACGGAGTGCTCGTCTCTTCATTTTCAATTGAACTTGCGGTCCGCTAGATTCCAAGATGGCAAAACGCTTCGCAGGAGTTAAAGTCAACTGGAATGCCAT CGTTGAACGGTTTCCTACCAAGGAGGAGGACCAGCTTTTAAAGCTCGCGAAGATCAGGAAAACCCACGAAACCTTCGTAAGAAGGGTTGCCGCTCTTCCC GAGAAGCCCCCAGCAATTGAGTGGGCCGCATACAAGAACAAAATCCCTGCCGCCTTTGTGGACTCCATTAAGCAGAAGTACGAGGCCATCCAGATCCCCT ACCCCAAGAACAATGCCGAAGAGATGATTAACAACAACGAGAAGGAGATGGCTGCCAAAGTCGCCAAGGCCAAGGAGGAGGGTAAGCTCACAATCAAGCA ACTGGAAGCAAAACTAGCC BLAST |
Tissue | pods |
Gene name | LI_gene_128616; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_297617
Blastp | ATP synthase subunit d, mitochondrial from Sophophora with 31.4% of identity |
---|---|
Blastx | ATP synthase subunit d, mitochondrial from Sophophora with 36.96% of identity |
Eggnog | energy coupled proton transport, down electrochemical gradient(ENOG4111IHJ) |
Kegg | Link to kegg annotations (Dmel_CG6030) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003591976.1) |
Pfam | ATP synthase D chain, mitochondrial (ATP5H) (PF05873.11) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |