| Id Trinity | TRINITY_DN46482_c0_g1_i3 |
|---|---|
| Name Transcript | Ll_transcript_391983 |
| Sequence | GGGAAAGCTTCCGCTCCGATCTCTCAACCCTTATCTTCCATCCTTCATCAACAACTCTCCTCTCCATCACCCTTTCTCACATCCAACCATTCGAAATGGC CTCCAGAATTGTCGCCCCCAAGATGGCCCAGATGGCCGCCCGCCCTGCCTTCCGCGCTGTCCAGCCCAAGGTCGCCCAGCGCGCCTTCTCTGGTCTCCGC CAGGCCACCCTCGTCCGCCCCCAGACCGTCTCCATGGTCCAGAAGCTCGCCCCCGTCTCCCGCCGTGCCTACTCCTCTGAGATGGCCAACGCCCTTGTTC AGGTCTCCCAGAACATTGGTATGGGTAACGCTGCTATCGGTCTCGGTGGTGCCGGTATCGGTATCGGATTAGTGTTCGCTGCTCTCCTCCAGGGTGTTGC CCGTAACCCCTCTCTCCGTGGCCAGCTCTTCTCTTACGCCATTCTTGGTTTCGCTTTCGTTGAGGCCATCGGTCTCTTCGATCTCATGGTTGCCATGATG TGCAAGTACGTGTAAACGTCTTCACCTCTGCAATGAGCGATGTCTATTGGGGAGTTCAAAGTCAGCCCCGGTCATGGAAACCAAAACATCGACGTGTACA TTATTCTCTATTGACGCCCGGAGGAATGAATTGTGGAAGGAAGACGACGACATGGCCAGGATACGACGGGGCTACTTCAAGACTTTCTTAAAAACAAACA AGAAAATCCTCTACTCATACATTGGGGâBLAST |
| Tissue | pods |
| Gene name | LI_gene_144950; |
| Additional information | details; |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_391983
| Blastp | ATP synthase subunit 9, mitochondrial from Podospora with 62.24% of identity |
|---|---|
| Blastx | ATP synthase subunit 9, mitochondrial from Aspergillus with 62.33% of identity |
| Eggnog | F(1)F(0) ATP synthase produces ATP from ADP in the presence of a proton or sodium gradient. F-type ATPases consist of two structural domains, F(1) containing the extramembraneous catalytic core and F(0) containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation (By similarity)(COG0636) |
| Kegg | - |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_016207714.1) |
| Pfam | ATP synthase subunit C (PF00137.20) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |