Id Trinity | TRINITY_DN48820_c1_g4_i1 |
---|---|
Name Transcript | Ll_transcript_284376 |
Sequence | CAGAGGTGGTGGTCAGATCATTCCCACAACCCGTCGTTGCCTGTACGCCTCTCAGCTGACCGCTGCCCCGAGGCTGATGGAGCCCGTGTACCTGTGTGAA ATCCAGTGCCCTGAGGTCGCTGTGGGTGGCATCTACGGTGTGCTCAACCGTAGGAGAGGTCACGTCTTCGAGGAACAGCAGGTGGCTGGTACACCCATGT TCGTCGTTAAGGCTTACCTTCCTGTCAACGAATCCTTCGGTTTCACCGCCGATCTCCGCTCGAATACCGGTGGCCAGGCCTTCCCTCAGTGTGTGTTCGA CCACTGGCAGATCCTTCCCGGTGACCCCCTGGACTCCGGCACCAAGCCCTTCACTGTTGTCCAGGACATCCGTAAGAGGAAAGGTCTCAAGGAAGGTCTC CCTGACCTCCAGTCCTACCTCGACAAACTGTAAATTACTGTTCTTGTTAGGTGTAAGAAAATTGAAAAGCCTCTCGAATGTCATTTACCCAAATTGTTTC TTTTGGAATTTTTTTAATGATATTTTACAGATAAGTAATCTTCAATGGGTGGTATTTTTTTCTATTGTGGTTTTATTTGTTAACACTTTGAGTGGTTGCC ATGCTAGAGGATTGCTGAGAGAAAGACCGTATGTACGAATGTGACATGAAATACG BLAST |
Tissue | pods |
Gene name | LI_gene_164195; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_284376
Blastp | Elongation factor 2 from Sophophora with 87.41% of identity |
---|---|
Blastx | Elongation factor 2 from Sophophora with 87.41% of identity |
Eggnog | Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post- translocational (POST) state as the newly formed A-site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome (By similarity)(COG0480) |
Kegg | Link to kegg annotations (Dmel_CG2238) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019425548.1) |
Pfam | Elongation factor G C-terminus (PF00679.23) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |