Id Trinity | TRINITY_DN49590_c0_g2_i2 |
---|---|
Name Transcript | Ll_transcript_407993 |
Sequence | TACACCCAAGTACTCTAAGGCTAGGTATGATGAAATCGTGAAGGAAGTTTCTTCTTATCTGAAGAAGGTTGGTTACAACCCAGACAAAATTCCATTTGTT CCCATCTCCGGTTTCGAGGGGGACAACATGATTGAGAGGTCCACCAACCTTGATTGGTACAAGGGCCCAACTCTTCTTGATGCTCTTGACCAGATCAATG AGCCCAAGAGACCCTCCGACAAGCCA BLAST |
Tissue | pods |
Gene name | LI_gene_170622; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_407993
Blastp | - |
---|---|
Blastx | Elongation factor 1-alpha from Lycopersicon with 98.67% of identity |
Eggnog | This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis (By similarity)(COG5256) |
Kegg | Link to kegg annotations (101244084) |
CantataDB | Link to cantataDB annotations (CNT0000351) |
Mirbase | egu-MIR172d (MI0020570) |
Ncbi protein | Link to NCBI protein (XP_019427228.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |