| Id Trinity | TRINITY_DN50494_c1_g1_i3 |
|---|---|
| Name Transcript | Ll_transcript_344932 |
| Sequence | TATACTTGTTATACTGGTATTGCAGATTTTGTGCCTGCTGACATTGATTCTGTTGGGTATGTCGTCTATTAGTCATGTATTATAGCCTTAATTACCTGTT TTCATTGACCCGTATCTATATTTTTGTTGAAAATACTTATATTATACCATATCATGTTGAAGCTTACTTGAAATTCTATGCTGGAAGGTACCGAGTTTTC TTG BLAST |
| Tissue | pods |
| Gene name | LI_gene_177602; |
| Additional information | - |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_344932
| Blastp | - |
|---|---|
| Blastx | Zeaxanthin epoxidase, chloroplastic from Lycopersicon with 86.96% of identity |
| Eggnog | oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen(COG0654) |
| Kegg | - |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (NP_001241348.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |