Ll_transcript_460080

• Id Trinity: TRINITY_DN51183_c1_g6_i1
• Name Transcript: Ll_transcript_460080
• Sequence: AAGAAGGCTTTCACCAAGTCTTCCAAGAAGTGGCAGGATGACCTTGGACGCAAGTCAATTGAAAGGAATTTCAAGAAAATGATCCGCTACTGCACAGTGA TCAGAGTTATCTGCCACACTCAGATGAAGCTGTTGAGGCATCGCCAGAAGAAGGCACACATTATGGAGATCCAGTTGAATGGAGGATCTGTAGAAGACAA GGTTAAGTGGGCACGTGAGCATTTGGAGAAGCCAGTACCTGTAGCC
• Tissue: pods
• Gene name: LI_gene_183017;
• Additional information: -

Expression of Ll_transcript_460080

FPKM

• PAB: 1.5
• PNAB: 0
• PS1: 0
• PS2: 0
• PS3: 0
• PW1: 0
• PW2: 0.8
• PW3: 0

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_460080

• Blastp: -
• Blastx: 60S ribosomal protein L3 from Sophophora with 75.61% of identity
• Eggnog: One of the primary rRNA binding proteins, it binds directly near the 3'-end of the 23S rRNA, where it nucleates assembly of the 50S subunit (By similarity)(COG0087)
• Kegg: Link to kegg annotations (Dmel_CG4863)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_020232633.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;