Id Trinity | TRINITY_DN78489_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_364555 |
Sequence | GAAAAACCTGAGACAGAAAAGATGAAGCATACCACTTTTCTTTTTGGAATTTTGGCTTTGTGGAGTGCTCTCTCGGTTATTGCAGAAGATAGATACCAAT TCTTCACATGGGAAGTTACTCAAGGAACCATTTCTCCTCTTGGTGTTCCTCAACAAGGAATTCTTATCAATGGTCAATTTCCAAGTCCTACAATTGAAGC AATCACTAATGACAATATAGTTGTGAATGTCATTAACAAGTTGGATGAGGCTTTCCTCATTACATGGAGTGGAATAAAACAGAGAAGGACATCATGG BLAST |
Tissue | pods |
Gene name | LI_gene_222520; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_364555
Blastp | Monocopper oxidase-like protein SKU5 from Arabidopsis with 56.18% of identity |
---|---|
Blastx | L-ascorbate oxidase homolog from Nicotiana with 62.35% of identity |
Eggnog | Multicopper oxidase(COG2132) |
Kegg | Link to kegg annotations (AT4G12420) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019433262.1) |
Pfam | Multicopper oxidase (PF07732.14) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |