Id Trinity | FTRINITY_DN11753_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_4502 |
Sequence | GTTCGACTCCGCAGAGCATTTTCCGACCTCGTTCCTACACGAATAATAATATACCTACCTACTTCTTTTAATATCTTCCTTTTCACGCAGGAATCAGCAA ACATAAGATGTTGTTCACCGGTTTAAGAGAAACGCTCTCCAAGCTCGTGCAGTCTCCTCTCTTCGTGGTCAGAGCCGAAGAAGAAGAAGAAGAACTAGTT GACCCAGCCAAGGTTTTGAGGGCTAAATGCGAACAACAAAAAGAAGCGCAAGAACGGTTTGCCAAGCTGCAAGAGTGTAACACTCGAGTAAACTCTAGAA AAGCAACAGCTGAAACCTGCGTTGAAGAATTCTGGGATTTTCTAGAAGTCGTTGATAAATGTGTTGCAAAAGACCTGTTTGATCATCTCAAGTGAATAAT CTATAATTTATGGTGTTGCAGTTTGACAGCCATTTAGCCTTAGGTATTTTATGTGTGGTATAATCCATTCTGTAAACAAAGATATGTTTTTACGATTACC CATTTCTTATTTTTTTTGATTTTCCAATAAAATCCGAGTTGATCATTGATAAAAT BLAST |
Tissue | flowers |
Gene name | LI_gene_398; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_4502
Blastp | - |
---|---|
Blastx | Cytochrome b-c1 complex subunit 6, mitochondrial from Homo with 45.45% of identity |
Eggnog | This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This protein may mediate formation of the complex between cytochromes c and c1 (By similarity)(ENOG411247S) |
Kegg | Link to kegg annotations (7388) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003593124.2) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |