Id Trinity | FTRINITY_DN11755_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_4504 |
Sequence | AGAGGACTTCCTGTTGCTGATCCATTCTTGGAAAAAGTAAAAATAAAAGACCTGGTCGAAGACGAAAGTCAGATTTTTGTGAAATTTTTTCGCTTCCATA AAACTTATGATCTCATACCAACTAGTGCAAAATTGGTTGTATTCGATACACAGTTGATCGTTAAAAAGGCGTTTTTTGCCTTGGTCTACAATGGTGTGCG AGCTGCTCCATTATGGGACAACAAGCGTCAGCAATTTGTGGGCATGCTAACTATT BLAST |
Tissue | flowers |
Gene name | LI_gene_399; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_4504
Blastp | - |
---|---|
Blastx | 5'-AMP-activated protein kinase subunit gamma-1 from Bos with 57.47% of identity |
Eggnog | Catalyzes the conversion of inosine 5'-phosphate (IMP) to xanthosine 5'-phosphate (XMP), the first committed and rate- limiting step in the de novo synthesis of guanine nucleotides, and therefore plays an important role in the regulation of cell growth (By similarity)(COG0517) |
Kegg | Link to kegg annotations (282324) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_014518823.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |