Id Trinity | FTRINITY_DN11834_c0_g1_i2 |
---|---|
Name Transcript | Ll_transcript_46230 |
Sequence | CTGCCAAGGAGCATATTGACATCTGTAGAGCTACAATAGACGAGAAGGTTGAAATACTGCAGGGAGAGAAAGCAATGGCAAAAACAGAGGAAGAGAAAGT GATAGCCCATGAGCGTGCAAAGGCTAGAAAAGCTAAAGCAAAGATGGAGATGCATGAAGCTAAAGCTAGGCATGCAGAGGAAAAGCTAAAGATCAAGCAA TATAGTCTCCCTAGTCATGAACCTCCACTGGTTGGATCTCAGCAGCCACTTGGTGCAGTTGCCATGCCAGGAAAAACCCATCCAAGTTATCCACTAGGTG GAAACCTTACAAGGAACAAGCATATGTAGGTAGCCATGTAGTTTTGAATTTCTCTTTCAGATATGTGTATTACAAGGGGTTAGTTTTTAACATGAATCCT TCTGTGTTTATGATGATTTGCATCTTTTGATTTTGATAAATGTTGGAAATAATTCGATGATGAGTTCTCTTTTGGTTTGTATTTTCAATTAAGTTAATAG TTATTCTAGâBLAST |
Tissue | flowers |
Gene name | LI_gene_423; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_46230
Blastp | Late embryogenesis abundant protein 6 from Arabidopsis with 43.7% of identity |
---|---|
Blastx | Late embryogenesis abundant protein 6 from Arabidopsis with 43.7% of identity |
Eggnog | late embryogenesis abundant group 1 domain-containing protein LEA group 1 domain-containing protein(ENOG410Z3PE) |
Kegg | Link to kegg annotations (AT1G32560) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019422919.1) |
Pfam | Late embryogenesis abundant (LEA) group 1 (PF03760.14) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |