| Id Trinity | FTRINITY_DN12209_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_266248 |
| Sequence | GGCGGGTCTAGCTTTGACAGTGGCTTTTTATTCAGTTGGTCATGTTTCTGGTGGCCATTTCAATCCTGCAGTTACAATTGCTTTGGCAGCAGTGGGAAAA ATTCAATTGAAACTTGTACCTATTTATGTGTTGTGTCAGTTTATGAGTGCTACACTGGCTACCTTCACCCTCAAAGTGCTGTATCATGATAAGGTCGATA TTGGAGTGACAGTGACTCAATTCACTA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_503; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_266248
| Blastp | - |
|---|---|
| Blastx | Aquaporin NIP1-2 from Arabidopsis with 51.52% of identity |
| Eggnog | Channel that permits osmotically driven movement of water in both directions. It is involved in the osmoregulation and in the maintenance of cell turgor during volume expansion in rapidly growing cells. It mediates rapid entry or exit of water in response to abrupt changes in osmolarity (By similarity)(COG0580) |
| Kegg | Link to kegg annotations (AT4G18910) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019461070.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |