| Id Trinity | FTRINITY_DN12607_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_176540 |
| Sequence | CTCGCTCGTCGCTGGAGATTTCGTCAGGGTCCCCCTGTATCGTGTACAATCAGCAAGACGGCAGCTTCAAGAAGTTGGCACTGCAGTTCAGCAACTGCGC CTACGTTATGGAGGCCCTACTCCTGAACCTCTATCAAACTATCTTGATGCCCAGTACTATGGCCCCATCAGCATCGGAAATCCTCCTCAGAGCTTCAAGG TGGTCTTTGATACAGGTTCATCAAACCTTTGGGTTCCTTCCAAAAAATGCCATTACACCAGCATTGCTTGCTTGTTGCACAACAAGTACGACAGCACTCG CTCC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_579; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_176540
| Blastp | Lysosomal aspartic protease from Stegomyia with 66.02% of identity |
|---|---|
| Blastx | Lysosomal aspartic protease from Stegomyia with 66.02% of identity |
| Eggnog | aspartic(ENOG410XNV7) |
| Kegg | Link to kegg annotations (AaeL_AAEL006169) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_016197480.1) |
| Pfam | A1 Propeptide (PF07966.11) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |