Ll_transcript_176531

• Id Trinity: FTRINITY_DN12622_c0_g1_i1
• Name Transcript: Ll_transcript_176531
• Sequence: GTTCTGTCAAAGTAAATATAATTTTGTCGGGTGCTCTTTTTTCAGTAATATAAAAACTTTATTAAATAAAGAGTAACAATGACCTCAACCGCAAATAAAG GAACTTTTCAACCGGATTCAGATGTGCACATTACCTATGAAGATCAACAAAAGATTAATAGGTTTGCAAGATTAAACGCCAAACTAGAAGATTTAAAGGA TGAAGTTAGAATTAAAGAGAACGATTTCCAAAGTATTGAAGATGCATGTGATGATATGGAGTTGT
• Tissue: flowers
• Gene name: LI_gene_581;
• Additional information: -

Expression of Ll_transcript_176531

FPKM

• FPAB: 0
• FPNAB: 0
• LF1: 0
• LF2: 0
• LF3: 0.8
• LF4: 0
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_176531

• Blastp: -
• Blastx: Prefoldin subunit 4 from Homo with 52.08% of identity
• Eggnog: Molecular chaperone capable of stabilizing a range of proteins. Seems to fulfill an ATP-independent, HSP70-like function in archaeal de novo protein folding (By similarity)(COG1382)
• Kegg: Link to kegg annotations (5203)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_013468972.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;