Ll_transcript_176542

• Id Trinity: FTRINITY_DN12640_c0_g1_i1
• Name Transcript: Ll_transcript_176542
• Sequence: GCATATCCCTCGATTCTTTGACATTTCTTTTTAGACGTTGAGCAAAATCAATAGAGTCTTGATGAAAAATTGGCCCATTATCCTCAGCATAAAAAATGCT TGGAAGAATTATTTGTTCAAAATTTTTTTTTTGTGCAGTTTCCAAGTCTTTCTGAATCACAGCTTTTGAGAGCCTAGTACCCGAGCTTGTGGATGAACTT TTAATGTTCTTCTGTCTCATTTCATGTTTAAATCTCTCCACCAGCTTCTCACATTCCCTCACTATGAAATTTATTTCCCTCACTCCATAACTCAATGCGG CTGTCTCCTTCGTCGAAATCAAGTCCTCGATTTCCCCCCC
• Tissue: flowers
• Gene name: LI_gene_587;
• Additional information: details;

Expression of Ll_transcript_176542

FPKM

• FPAB: 0
• FPNAB: 0.2
• LF1: 0
• LF2: 0
• LF3: 0
• LF4: 0
• UF1: 0
• UF2: 0.2
• UF3: 0.2
• UF4: 0.4

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_176542

• Blastp: Probable inactive ATP-dependent zinc metalloprotease FTSHI 5, chloroplastic from Arabidopsis with 45.95% of identity
• Blastx: Probable inactive ATP-dependent zinc metalloprotease FTSHI 5, chloroplastic from Arabidopsis with 45.95% of identity
• Eggnog: Acts as a processive, ATP-dependent zinc metallopeptidase for both cytoplasmic and membrane proteins. Plays a role in the quality control of integral membrane proteins (By similarity)(COG0465)
• Kegg: Link to kegg annotations (AT3G04340)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019439926.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;