| Id Trinity | FTRINITY_DN13000_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_183393 |
| Sequence | CTACTGTGCATTCTCAACATTGAATATTTATGATGGATAATGGACAAACAACAAAAACCGTGCACCAAGTGACCTCAGCTCCAACTGACTCCAAACCCAC TCTGATGAAAGTTTCTTCGTATTTATTGGCCTTACGACCATGGTCACTCAGTGCATCATTAATGCCAACTTTAACTGGCTGTGCGCTTGCCTATAAACTT AGTCC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_647; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_183393
| Blastp | - |
|---|---|
| Blastx | UbiA prenyltransferase domain-containing protein 1 homolog from Sophophora with 63.64% of identity |
| Eggnog | 1,4-dihydroxy-2-naphthoate octaprenyltransferase(COG1575) |
| Kegg | Link to kegg annotations (Dmel_CG5876) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003523709.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |