| Id Trinity | FTRINITY_DN13072_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_183399 |
| Sequence | CCAAGAAGCGCGCTCAGCGTGCCACATCTAATGTCTTCGCCATGTTTGATCAGGCACAAATCCAGGAGTTCAAGGAAGCTTTCAACATGATTGATCAGAA TAGGGATGGTTTTGTCGATAAGGAAGATCTTCATGACATGCTGGCCTCCCTTGGTAAAAACCCAACTGACGAATACCTGGAAGGCATGATGAATGAAGCC CCAGGACCCATCAACTTCACTATGTTCCTCACCCTCTTTGGGGAGCGCCTCCAGGGCACGGACCCAGAAGATGTCATCAAGAATGCTTTTGGTTGCTTTG ATGAAGAGAATCAGGGTGTCATCCACGAAGAGCGACTCCGCGAGCTCCTCATCAGCATGGGTGACCGCTTTTCCGCTGAAGACG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_667; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_183399
| Blastp | Myosin regulatory light chain sqh from Sophophora with 89.47% of identity |
|---|---|
| Blastx | Myosin regulatory light chain sqh from Sophophora with 90.55% of identity |
| Eggnog | Calcium-binding protein(COG5126) |
| Kegg | Link to kegg annotations (Dmel_CG3595) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_014512636.1) |
| Pfam | EF-hand domain pair (PF13499.5) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |