| Id Trinity | FTRINITY_DN13725_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_3049 |
| Sequence | CAAGAGCAGGTGCAGGTCCACCTCGGCCCCCAAGTGCGCGAAGGTGAAATTGTGTTTGGTGTGGCACACATCTTTGCCAGTTTCAACGACACATTTGTCC ATGTCACTGATTTGTCTGGGCGTGAAACCATTGCCCGAGTGACTGGTGGTATGAAAGTCAAGGCTGACCGTGATGAAGCTTCTCCCTACGCTGCTGTGTT AGCCGCTCAGGATGTTGCTGAGAAGTGCAAGACCCTTGGCATCACTGCTCTCCACATCAAGCTGCGTGCCACTGGTGGTAACAAAACCAAGACTCCAGGC CCTGGTGCACAGTCTGCTCTGCGAGCTCTTGCTCGTTCTTCCATGAAAATTGGTCGCATTGAAGATGTTACCCCCATTCCATCAGATGCCACCAGGAGGA AGGGAGâBLAST |
| Tissue | flowers |
| Gene name | LI_gene_773; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_3049
| Blastp | 40S ribosomal protein S14b from Sophophora with 94.66% of identity |
|---|---|
| Blastx | 40S ribosomal protein S14b from Sophophora with 94.66% of identity |
| Eggnog | - |
| Kegg | Link to kegg annotations (Dmel_CG1524) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_016190479.1) |
| Pfam | Ribosomal protein S11 (PF00411.18) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |