| Id Trinity | FTRINITY_DN13790_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_3039 |
| Sequence | AGCATGGGAGATCACACAGAAGTAGTAGATATAGACTATGATCCAAAAGTAATTAGTTATGAAGATCTTTTACAAATGTTCTGGAACAACCACGAATATG GCCTAACTACTATTATTAAAAAAACAATACATGTCTTTAATTCTCTACCACGATGAAGACCAAAAAAGGATAGCAGAAATTTCGTTTAAAAAGCAAGAAA ACAAAACTAAAGAAAAGCTTATCACAGTTATCGCTCCTGCTGGCCCAATGTATCCTGCTGAAGATTATCATCAAAAATACAGACTTCAAGGACACCCATC TCTATGCAAGGACATTGGTCTCACTCCAGAACTTCTCCAGTCCTCCCACATCGCCGCAAAACTGAACGGCTACGTGGCTGGCTTAGGCACCATAGAAGAC TTGGAAAAAATCGCGGCAAAATATAATTTAACTGAAAAAATTACATCCTACGTACGTCAACAAATGAAAGAAAACGAAGGAGGCAGTTTGTTCTGCTGAA TCTATAACâBLAST |
| Tissue | flowers |
| Gene name | LI_gene_784; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_3039
| Blastp | Peptide methionine sulfoxide reductase from Sophophora with 48.36% of identity |
|---|---|
| Blastx | Peptide methionine sulfoxide reductase from Sophophora with 48.44% of identity |
| Eggnog | Has an important function as a repair enzyme for proteins that have been inactivated by oxidation. Catalyzes the reversible oxidation-reduction of methionine sulfoxide in proteins to methionine (By similarity)(COG0225) |
| Kegg | Link to kegg annotations (Dmel_CG7266) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_016190424.1) |
| Pfam | Peptide methionine sulfoxide reductase (PF01625.20) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |