| Id Trinity | FTRINITY_DN14291_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_86355 |
| Sequence | ATCTCGCCGCGCCCGAAGCCCAGGGCACCACGATGCCCGATGCCTCGGCGCCGCACGGCGACGCCCAGCCCGCCGGCAAGCAGTCGTTCGACGAGGTCTT CAGGCAGGACAAGGCTTACTCGGGCGAGTGGGCGCAGACGGCCGGCCGCTTCAAGCCTGCGTACAGGCCTGTGCCGCAGAGGTGGAAGAACAGTGAGATT TTGTCCCGGTTGAGATCGCACGTGAAGTCGCC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_885; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_86355
| Blastp | - |
|---|---|
| Blastx | Succinate dehydrogenase assembly factor 2, mitochondrial from Penicillium chrysogenum species complex with 54% of identity |
| Eggnog | the catalytic subunit of succinate dehydrogenase (SDH). SDH is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q). In is unclear whether it participates in the chemistry of FAD attachment (enzymatic function) or acts as a chaperone that maintains(COG2938) |
| Kegg | Link to kegg annotations (Pc22g03150) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_014490211.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |