| Id Trinity | FTRINITY_DN14777_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_247437 |
| Sequence | ATTTTTTTTTTTTTTTTGAAAATCAATTCAACAACTCACAGAAATAAAAACTAAGACAAAAGAAAAATTTGGAGAAAAAAAAGAAAGTATTTTTGAAGGA CACATTATGCTTCTTGAAGATGAAGAGCTAGAACAAGAAGTTATTTCTTTAATAAAAGAAAAAAATATGTCGGCTGCAGCAGCAACTGAATTAATTATTG AA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_986; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_247437
| Blastp | - |
|---|---|
| Blastx | Phosphoenolpyruvate-protein phosphotransferase from Buchnera with 94.03% of identity |
| Eggnog | General (non sugar-specific) component of the phosphoenolpyruvate-dependent sugar phosphotransferase system (sugar PTS). This major carbohydrate active-transport system catalyzes the phosphorylation of incoming sugar substrates concomitantly with their translocation across the cell membrane. Enzyme I transfers the phosphoryl group from phosphoenolpyruvate (PEP) to the phosphoryl carrier protein (HPr) (By similarity)(COG1080) |
| Kegg | Link to kegg annotations (BU064) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | - |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |