| Id Trinity | FTRINITY_DN1499_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_3246 |
| Sequence | GATTATTTTATTGCAGAAACATCAAAAATATAAATAGATTGTTTGGAAGTCAAAATGGAACAACCAAAGAACGACGATTTACAAGATGGTATGTCAGCTA CTGAAATGATCAACATGGGAAATGGTCTAACTTATAATGATTTTATCATTTTGCCTGGCTACATTGATTTCTCACCCGACCAAGTCACCCTGGCTAGTCC TTTAACCAAAAAAATCAACATCAAAGCTCCACTTGTCTCATCACCAATGGACACTGTCACCGAGTCGGACATGGCCATCGCGATGGCGCTCTGTGGAGGT ATTGGTATTATCCATCACAACTGTTTGCCGAGCTACCAGGCCAATGAAGTGCTCAAGGTGAAAAAATACAAGCACG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_1039; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_3246
| Blastp | Inosine-5'-monophosphate dehydrogenase from Sophophora with 74% of identity |
|---|---|
| Blastx | Inosine-5'-monophosphate dehydrogenase from Sophophora with 63.41% of identity |
| Eggnog | Catalyzes the conversion of inosine 5'-phosphate (IMP) to xanthosine 5'-phosphate (XMP), the first committed and rate- limiting step in the de novo synthesis of guanine nucleotides, and therefore plays an important role in the regulation of cell growth (By similarity)(COG0516) |
| Kegg | Link to kegg annotations (Dmel_CG1799) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003624628.2) |
| Pfam | IMP dehydrogenase / GMP reductase domain (PF00478.24) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |