Id Trinity | FTRINITY_DN15364_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_216409 |
Sequence | CTGTCTGTTAAAGTTCATCCCGTAGTTTTATTTCAAATTGTCGATGCCTACGAAAGGAGAAATGCTGACGCTCACCGAGTTATCGGAACGTTGTTAGGAT CTGTTGAGAAAGGTGTTGTCGAAGTCACAAACTGCTTCTGTGTACCTCACAAAGAATACGATGATATGGTGGAAGCTGAAATTATGTATGCAAAAGAAAT GTTTGATTTCATCAAGCGAGTTAACCCTCAAGAAAATATTGTGGGTTGGTGGGCTACAGGTCAAGAGGTGACTTCTCATTCTTCAGCAATCCATGATTTT TACTCCCGAGAATGCGCAAACCCAATCCATTTAACTTTGGACACCACTCTTCAAGGAGAAAGAATGGGTATCAAAGCGTACCTGAACGTACCTATTGGTG TACCCGGTGGCAAGGGTGGCTGCATGTTCACTCCTATTTCCGTTGATGTCACCTGTTATGAGCCTGAAGTTGTGGGAATTCAGCTGGCTAGCAAAACAGC TCAAATGGCACACAACGAC BLAST |
Tissue | flowers |
Gene name | LI_gene_1192; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_216409
Blastp | Eukaryotic translation initiation factor 3 subunit F from Stegomyia with 73.84% of identity |
---|---|
Blastx | Eukaryotic translation initiation factor 3 subunit F from Stegomyia with 73.84% of identity |
Eggnog | Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome (By similarity)(COG1310) |
Kegg | Link to kegg annotations (AaeL_AAEL009101) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003616582.1) |
Pfam | JAB1/Mov34/MPN/PAD-1 ubiquitin protease (PF01398.20) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |