| Id Trinity | FTRINITY_DN15668_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_13099 |
| Sequence | AGCTTGTGTTCCAACCCACGTGGCAAGCATTAAATCACCATACTGGGCCCCACCATCTTCTAATCTATACCACTGTGGGGCCAGAGGGCTATCTGGTGGG TCCCTCACAGGAATCTCATTCACATCAAAACAAACTCCACCAAGCAAGCTTTGATTCATTAATTCTGGGTCCCACACAGAGACCTCAAGAATGGAGGAGG AATCTGGTGCTTCGCGGCTGAAAGCGAATGTTTGGTTCCATTCGAATAACGTTGTGTTACTATTTTTCCGTGCGGGTCTTGATGTGACGTGGTGGTTAGA AACGGTAATCTTCACAATAGGGTTCATGT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_1286; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_13099
| Blastp | Protein QUIRKY from Arabidopsis with 51.3% of identity |
|---|---|
| Blastx | Protein QUIRKY from Arabidopsis with 51.3% of identity |
| Eggnog | Plant phosphoribosyltransferase C-terminal(ENOG410Y912) |
| Kegg | Link to kegg annotations (AT1G74720) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019427611.1) |
| Pfam | C2 domain (PF00168.29) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |