Ll_transcript_65932

• Id Trinity: FTRINITY_DN15799_c0_g1_i1
• Name Transcript: Ll_transcript_65932
• Sequence: CTGAATTCGTTGCCCTTTATATTCTTCTTCTAAACTCTTCACACCGTTCCATATTTTAACCTTCTTCCTGCGATGGCCCAACGAAATAGGGTAAGAAATT TCGCTAACAAACTCAAAGACAAAGCTTCACTCATCGCAGCATCATTATCCTTCAACCGCCACGTGTCTTCCATCCATGTCCACGTCATCCGCGCCACCAC CCACGCCCTCGCCGCCACTCCCTCAGAGTCAACAATCGCCGCCGTCCTCAACGTCGGCCGCGGCCGACAACAGCAATTCCAACGTGCATGCATCGACGCG CTCATGGAACGTCTTCACCGCACGCGCAGCGCCTCTGTCGCCATGAAATGCCTCTTCACCCTCCACAACGTTGTTGTTAAAGGAC
• Tissue: flowers
• Gene name: LI_gene_1349;
• Additional information: details;

Expression of Ll_transcript_65932

FPKM

• FPAB: 1
• FPNAB: 0.9
• LF1: 0.6
• LF2: 0.6
• LF3: 1.4
• LF4: 1.5
• UF1: 0.7
• UF2: 0.8
• UF3: 1.9
• UF4: 0.7

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_65932

• Blastp: Putative clathrin assembly protein At4g40080 from Arabidopsis with 37.14% of identity
• Blastx: Putative clathrin assembly protein At4g40080 from Arabidopsis with 36.79% of identity
• Eggnog: Clathrin assembly protein(ENOG410XQ90)
• Kegg: Link to kegg annotations (AT4G40080)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019415789.1)
• Pfam: ANTH domain (PF07651.15)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;