| Id Trinity | FTRINITY_DN15803_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_40924 |
| Sequence | CATTGCAAGTTGCAGAAGTCGGAGTTCATTTCGGTCGGCAGGAAGGATTCCTGCAGTTTTCTATCCTGAAAGTAGAAAAATACCTAACAGTCCACCATGT CAGGCTGGAGAGCAGCGGGTCTTACCTACATTCGGTACTCCAACATCGCCGCCAAGTGCGTCAGGGAAGCCCTGAAAGCCGACCTGCGCGCTGCCGCCGC CAAGCGTGAAGACTCCTCCGTCAGAATGACACCGTGGAAGGACGGAAAGCCCAACAAAGGAGCCACAATCCCTGGCACTGAGTGAAGATATGGATCCATC CTAAGATAGGTTAGCTGCTGTGTACACCTCAGACTCATGTGAGTCTACTGTTCAGAACTGTCAATGTTA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_1353; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_40924
| Blastp | - |
|---|---|
| Blastx | Protein stunted from Sophophora with 61.4% of identity |
| Eggnog | Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core, and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Part of the complex F(1) domain and of the central stalk which is part of the complex rotary element. Rotation of the central stalk against the surrounding alpha(3)beta(3) subunits leads to hydrolysis of ATP in three separate catalytic sites on the beta subunits(ENOG410Y5P5) |
| Kegg | Link to kegg annotations (Dmel_CG9032) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003613764.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |