| Id Trinity | FTRINITY_DN15909_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_98109 |
| Sequence | GGTGATACTAAGGAACAGGGTTGCAGAACAAGTATAGGAGGAAAAGTAGTGAATAAAAATGGGAAAGGACATCATCAGTTCTATGCCAAATGAAATCATT GCAATGATTTTAACTCTATTGACTCTCAAAGAAGCTGTAAGGACTAGCATCTTATCTAGAAGGTGGAAGAATCTATGGACATTTTTCTCTGGTTTCTTAA CCTTTGATAACTCGATGAAGACTCTACACATGTATCGAGATAGGAAGACTTCAAAGCGGAAAAAATGTATTCAATTTGTAAATGAGTGGGAGAAGTTCAT GAGTAATTTGGAACGTGTGCTAAGATCGATAACTAGCCCATCGTTGCAAGGACTAAG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_1391; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_98109
| Blastp | F-box/LRR-repeat protein At3g58900 from Arabidopsis with 36.47% of identity |
|---|---|
| Blastx | F-box/LRR-repeat protein At3g58900 from Arabidopsis with 36.47% of identity |
| Eggnog | F-box domain containing protein, expressed(ENOG410ZC2N) |
| Kegg | Link to kegg annotations (AT3G58900) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019465309.1) |
| Pfam | F-box domain (PF00646.32) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |