Id Trinity | FTRINITY_DN16371_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_247923 |
Sequence | ATCTGTGAGAGCTGCACTAACCCATGTTTGTACATTGCTCATATGCCATGCAAAGTCCTCTCCCACCATCTGATTCATCTTGCCTAGTTCCCGAACCGAT TGGCTAAGGCTGCTAATGCTATCACTCATGTTCTCTATGCAGTCCTGCACAGCCCTGTACTCCCTAGGCCTAATGCCACTTGCTTTGGCAATATTCTTCA CAAATGAAGCGCATGACCGCGTCCTTGTTATGCTCACTGACAAAGCTGTCATGGCTAGTTGCCTCTCGCTGTGGCCGATCACATTCGCATACGCCGACAG ACTTTGAACACATAAGGTGGAGTAGCAAGTTGCTCTACATGAGGACTTGATGAAGTTTGCAGGGTTAGGGGTTGATTTTCTAGGAATGGCAGATTCTGCA GTGCTAGACATGA BLAST |
Tissue | flowers |
Gene name | LI_gene_1497; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_247923
Blastp | 21 kDa protein from Daucus sect. Daucus with 48.31% of identity |
---|---|
Blastx | 21 kDa protein from Daucus sect. Daucus with 48.31% of identity |
Eggnog | - |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019421568.1) |
Pfam | Plant invertase/pectin methylesterase inhibitor (PF04043.14) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |