Ll_transcript_16528

• Id Trinity: FTRINITY_DN17397_c0_g1_i1
• Name Transcript: Ll_transcript_16528
• Sequence: AAAGTGGAGAGGAGTGACCTGCAACACTGACCAATCAAGAGTTATAGCTCTCAGATTGCCTGGAGTTGGTTTAAGTGGTCCACTCCCAAACAACACTCTT AGTCTCCCTTCAGCACTTCAGATTCTGAGTCTTGAATCAAATAGTATAACTGGTCCTTTCCCTTCTGGTTTCACTGAGCTAAAAAATTTGACCAGACTCT ATCTCCAGTTTAATAAGTTTTCAGGTCCATTGCCATTAGATTTTTCAGTTTGGAATAGTCTCAGTGTTGTTAATCTGTCCAACAATTCTTTTAATGGGAG CATTCCTTCTTCAATTTCAAATTTGAC
• Tissue: flowers
• Gene name: LI_gene_1734;
• Additional information: details;

Expression of Ll_transcript_16528

FPKM

• FPAB: 0.2
• FPNAB: 0.4
• LF1: 0.8
• LF2: 0.2
• LF3: 0
• LF4: 0.2
• UF1: 0.8
• UF2: 0.2
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_16528

• Blastp: Probable inactive receptor kinase At4g23740 from Arabidopsis with 67.29% of identity
• Blastx: Probable inactive receptor kinase At4g23740 from Arabidopsis with 67.29% of identity
• Eggnog: Leucine rich repeat N-terminal domain(ENOG410YDXU)
• Kegg: Link to kegg annotations (AT4G23740)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019417228.1)
• Pfam: Leucine Rich Repeat (PF00560.32)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;