| Id Trinity | FTRINITY_DN17510_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_209158 |
| Sequence | CTGCTTTTTTTTTTTTTTTTCCTCCTGTTGAGCTTTTTTCTTCCATGACTCGGATGAGTTAAGTTGATCCTTAGCTCTCTTCAGATCTTCTTGAAGCTGA GCAATCTGAGACTCCAACTCCTTGATCTTCTTAGTAGGTCGCTTCTTCTCAACCATTGGACTTTGTGGTGACTTTTGTTCATTCACCTTCGGACTCCGAT CTTTCGGAGTCTTTCTTGCAGAGTGTGGAGAGGAATCAGAGTTCGGTGTCTCTAACTGGCGAACCGTCTTCGGAGTTGCAGGAGATTTCTTATGAGGCGC TTTTGAAG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_1772; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_209158
| Blastp | Interactor of constitutive active ROPs 2, chloroplastic from Arabidopsis with 52.83% of identity |
|---|---|
| Blastx | Interactor of constitutive active ROPs 2, chloroplastic from Arabidopsis with 55.17% of identity |
| Eggnog | interactor of constitutive active rops(ENOG410YE21) |
| Kegg | Link to kegg annotations (AT2G37080) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003520644.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |