| Id Trinity | FTRINITY_DN18211_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_243777 |
| Sequence | AGGAATCACTCAGCAGATAGGAGCGACAAACGTTCCTATTGAAGCAATTAAGGAGCAAGTCAAAATAGTGAAAGGGTTTGATGAAAATGATCTAAGAATC CCCGGTCTCCTCATCATTGACACACCTGGTCACGAGTCTTTCTCAAACTTGAGAAATCGTGGATCGTCGCTCTGTGATATTGCAATTCTTGTAGTTGATA TTATGCATGCATTAGAACC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_1901; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_243777
| Blastp | - |
|---|---|
| Blastx | Eukaryotic translation initiation factor 5B from Mus with 83.33% of identity |
| Eggnog | One of the essential components for the initiation of protein synthesis. Protects formylmethionyl-tRNA from spontaneous hydrolysis and promotes its binding to the 30S ribosomal subunits. Also involved in the hydrolysis of GTP during the formation of the 70S ribosomal complex (By similarity)(COG0532) |
| Kegg | Link to kegg annotations (226982) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_014513446.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |