| Id Trinity | FTRINITY_DN19034_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_210177 |
| Sequence | AAAGTCTCCTAGGGAGGATTTGCTAGTAAAAACAGACAATGAGCATGGTGCATGCGCTTTGTGTGCTCTTGACTTAGAAGTGAAACATACTGACATTTTA ATCATTAAACAATTTATGGATCACAATGCACAACTGTATCCTAGACATATAACTGGGTTGTGCAGATGGCAGCAACGCAAAATGAAATATCTTATCGAAA TGGCTG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_2036; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_210177
| Blastp | - |
|---|---|
| Blastx | 28S ribosomal protein S18a, mitochondrial from Mus with 37.29% of identity |
| Eggnog | Binds as a heterodimer with protein S6 to the central domain of the 16S rRNA, where it helps stabilize the platform of the 30S subunit (By similarity)(COG0238) |
| Kegg | Link to kegg annotations (68565) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_013450941.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |