| Id Trinity | FTRINITY_DN19509_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_173283 |
| Sequence | GAAGTGACTTTAGAAGAATCAATACGTTACAAACCTGGTGATGATGTAGAAAAATGGTTGACTAATCTGTTGTGTCTTGATGCAACAAATATTGCTCCAC TGCTTTCAGGCTGCCCTCCTCCTGATAGATGTGATCTGTATTATATCAATAGAGATACTTTATTTTGTTACCATAAGGCGTCAGAAGCTTTCTTGCAGCG A BLAST |
| Tissue | flowers |
| Gene name | LI_gene_2112; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_173283
| Blastp | - |
|---|---|
| Blastx | RNA cytidine acetyltransferase from Sophophora with 65.15% of identity |
| Eggnog | Catalyzes the formation of N(4)-acetylcytidine (ac(4)C) at the wobble position of tRNA(Met), by using acetyl-CoA as an acetyl donor and ATP (or GTP) (By similarity)(COG1444) |
| Kegg | Link to kegg annotations (Dmel_CG1994) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_014511738.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |